| lucille c on Sun, 26 Apr 2009 17:42:57 +0200 (CEST) |
[Date Prev] [Date Next] [Thread Prev] [Thread Next] [Date Index] [Thread Index]
| [Nettime-ro] °°° |
- <https://webmail.noserver.org/src/left_main.php?fold=INBOX>
- <https://webmail.noserver.org/src/left_main.php?fold=INBOX>
- <https://webmail.noserver.org/src/left_main.php?fold=INBOX>
- <https://webmail.noserver.org/src/left_main.php?fold=INBOX>
- <https://webmail.noserver.org/src/left_main.php?fold=INBOX>
- <https://webmail.noserver.org/src/left_main.php?fold=INBOX> â [image:
jkhgjg par loychan] <http://www.flickr.com/photos/loychan/3434161883/> nb :
âââââããÍ[image:
Amour]<http://fr.wikipedia.org/wiki/Fichier:Nuvola_emblem-favorite.svg>
Ù <http://fr.wikipedia.org/wiki/Fichier:Animalien-smiley.gif>atfg :
[ÌÌÂÌâÕââââdnftt : ââãâ]ÍãØâotf : ááââÖÊÌØËÌÌÌÙÛâ.ãâðäy : ×ÖÛÖÛâàáàffs :
ãàààààêááâââgg : ââáÌðËirl :âÌÌÍðâââËÌâ[]ââãËËËÇâââââââââââââââââ mai27>28
de midi à minuit
*WJ-SPOTS #1
15 ans de crÃation artistique sur internet
maison des mÃtallos 94 rue jean-pierre timbaud **.paris11
futur en seine / les immatÃrielles*
Deux journÃes dâinterventions pendant lesquelles une cinquantaine
dâartistes, critiques, penseurs, inventeurs, chercheurs, commissaires
artistiques et organisateurs dâÃvÃnement franÃais font un point sur 15
annÃes dâexistence dâInternet. Sous un angle artistique, ils commentent,
analysent et retracent  l'histoire  du web et la maniÃre dont le rÃseau a
Ãtà investi comme un espace de crÃation (crÃations en ligne, Åuvres
collectives, pratiques de tÃlÃprÃsences, performances en rÃseau net art,
online art, sofware art, code art, ascii art, flash art, google art, art
gÃnÃratif, art interactif, art collaboratif, tactical media, locative media,
art telematicâ).
Publication papier à venir et intÃgralità de lâÃvÃnement filmÃe, retransmise
en direct sur Internet et ensuite archivÃe sur le serveur de MCD - Musiques
et cultures digitales
[image: hjgfhf par loychan]<http://www.flickr.com/photos/loychan/3434160423/>
â ▲ â ► â ▼ â ◄ â ■ â □ â ▣ â▤
â ▥ â ▦ â ▧ â ▨ â ▩ â ▪ â ▫
â◊ ◊
â ○ â ● â ☺ â ☻ â ☼
*juin0**8>15** 19:30
monstration#3 au bord du gouffre* *d'aprÃs david wojnarowicz
La Bellone 46 rue de flandre .bruxelles*
*rÃservation conseillÃe (jauge limitÃe)** = 0032 (0)2 513 33 33 OU
infos@bellone.be
<http://www.myrtilles.org/news/wp-admin/infos@bellone.be>**
mise en scÃne lucille calmel** / scÃnographie gaÃtan rusquet** / avec
sÃbastien lenthÃric et mathias varenne / traduction laurence viallet aux
Ãditions dÃsordres / production et diffusion sylvia botella** / projet
accompagnà par La Bellone Maison du Spectacle, le Manege.Mons/CECN2 avec le
soutien de LâAgence Wallonie Bruxelles ThÃÃtre/Danse, Le Centre des Arts
ScÃniques, la Cie U-Structure Nouvelle (F)*
<http://2.bp.blogspot.com/_Xi_abSwXMIo/SY73YvlLQGI/AAAAAAAAAFs/lgMXkmPTm1A/s1600-h/I-mage+17.png>
*
*
*juin25*
*so,und programmation logement **hogeweg 90* *.anvers/antwerpen*
*sÃbastien rien
*
*sÃbastien biset + Jean DL, Impostor, SÃbastien Karkoszka**
*
*marc jacobs & lucille calmel*
[image: Image 4]<http://www.msplinks.com/MDFodHRwOi8vd3d3LmZsaWNrci5jb20vcGhvdG9zL2xveWNoYW4vMzM4NTQzNTM1My8=>[image:
Image 4]<http://www.msplinks.com/MDFodHRwOi8vd3d3LmZsaWNrci5jb20vcGhvdG9zL2xveWNoYW4vMzM4NTQzNTM1My8=>[image:
Image 4]<http://www.msplinks.com/MDFodHRwOi8vd3d3LmZsaWNrci5jb20vcGhvdG9zL2xveWNoYW4vMzM4NTQzNTM1My8=>
*juillet23>28
*
*code 408 - double virgule (sigle : **Â , , Â)*
*GÃnÃralement sÃparà par une espace, la double-virgule sert à indiquer, dans
une ÃnumÃration l'article, le nom, le verbe qui ne nous vient pas tout de
suite à l'esprit.*
*du cÃtà de chez soi rencontres d'Ãtà cnes chartreuse .villeneuve les
avignon*
Avec Annie Abrahams, Lucille Calmel, RÃmi Checchetto, Sonia Chiambretto, Eli
Commins, Joseph Danan, CÃlia Houdart, Antoine Pickels, Sabine Revillet,
Carole Thibaut.
[image: hgjhfghf par loychan]<http://www.flickr.com/photos/loychan/3434159667/>
*cimatics/intermerz/exhibition
*
[image: e par loychan] <http://www.flickr.com/photos/loychan/3388643682/>
*http://webtv-prosvia09.blogspot.com/2009/04/interview-lucille-calmel.html*
[image: b par loychan] <http://www.flickr.com/photos/loychan/3387831503/>
*> *Charmed
[image: Ãcrivains en sÃries] *Ãcrivains en sÃries*
*Un guide des sÃries tÃlÃ*
* Collectif - Ãcrivains en sÃries*
parution 1er avril09
Env. 500 pages
20 euros
isbn 978-2-7561-0150-7
EAN 9782756101507
240 x 155, brochÃ
Avec le rockân roll, les sÃries tÃlà sont peut-Ãtre lâauthentique crÃation
Ãtatsunienne du vingtiÃme siÃcle et lâun des matÃriaux principaux dont ne
cesse de se nourrir la crÃation contemporaine.
*Alfred Hitchcock prÃsente, La QuatriÃme Dimension, Star Trek, Le
Prisonnier, Amicalement vÃtre, Columbo, Dallas, Derrick, Twin Peaks,
Friends, Lost, Sopranos, The wire, Oz, Profit, Les Experts, Six Feet Under,
lâhÃpital et ses fantÃmes, Sex and The City, AbâFabâ, The Simpsons, 24
heures, South Park, Nip/Tuck, Rome* pour les plus cÃlÃbres dâentre elles
mais Ãgalement des trÃsors tÃlÃvisuels mÃconnus comme *La maison des
bois*de Maurice Pialat, des dessins animÃs japonais cultes comme
*LAIN* ou honk-kongais, des comÃdies anglaises, des sÃries australiennes et
canadiennes vues par *Mark Alizart, StÃphane BÃrard, Vincent Bergerat,
Philippe Boisnard, Anne Bourse, GuÃnaÃl Boutouillet, Lucille Calmel, David
Christoffel, Claro, Thomas Clerc, Sylvain Courtoux, BÃatrice Cussol, Anna
Czapski, Julien DâAbrigeon, Dahlia, Angie David, David Defendi, Vincent
DelaboudiniÃre, FrÃdÃric Dumont, Lise Etcheverry, Alain Farah, Guillaume
FÃdou, Claire Fercak, Christophe Fiat, Ãmilie Florentin, Daniel Foucard,
Fabrice Gaignault, Bastien Gallet, JÃrÃme Gontier, Laurent Goumarre, Claire
Guezengar, Georges HassomÃris, Hortense Hubben, Ãlodie Issartel, Dominiq
Jenvrey, Manuel Joseph, Laure Limongi, Marc Lits, Vannina Maestri, JÃrÃme
Mauche, Olivier Mellano, Laure Mentzel, Pierre MÃnard, Nataschka Moreau,
Joseph Mouton, Tarik Noui, Charles Pennequin, CÃlia Picciocchi, Emmanuel
Pierrat, Emmanuelle Pireyre, Emmanuel Rabu, Samuel Rochery, Nicolas Rollet,
Sophie Rosemont, Arnaud Saint-Martin, Peggy Sastre, LÃo Scheer,
Jean-Baptiste Scieux, Orion Scohy, Olivier SÃcardin, Sarah Sepulchre, Yvan
Serouge, Jacques Sivan, Florent Souillot, Nathalie Talec, Vivianne de Tapia,
ClÃment Tuffreau, Emmanuel Tugny, Philippe Vasset, HÃlÃna Villovitch*â
Collectif dirigà par *Emmanuel Rabu*.
Image de couverture : *Danny Steve*.
[image: nvgjhf par loychan]<http://www.flickr.com/photos/loychan/3434970088/>
*> suspension*
en  Fractal Musik nÂ4 : CRUNCHY-CRUNCH Â, revue sonore de JoÃl
Hubaut , CD coÃditÃ
par la Station Mir - La poÃsie/nuit , sortie mars09
in  Fractal Musik nÂ4 : CRUNCHY-CRUNCH Â, sound review by JoÃl
Hubaut , CD coedited
by Station Mir - La poÃsie/nuit , out march09
avec/with P. Nicolas Ledoux, FrÃdÃric Acquaviva, Art Orientà objet, Pierre
BeloÃin, Marie Boisgontier, Philippe Boisnard & Michel Giroud, Sophie
Boursat, Lucille Calmel, LoÃc Connanski, Alain Coulange, FrÃdÃric Danos, Das
DingbÃt, Dead Sexy Inc, Fred Debief, Carla Demierre, Jean-jacques Dumont &
Robin DC, Mohamed Elbaz, Vincent Epplay, Yvan Etienne, Christelle Familiari,
David Fenech, JÃrgen Fritz, HP Process, JoÃl Hubaut & LÃa Le Bricomte, Rolf
Julius, Eddie Ladoire, Bernard Lallemand, Matthieu Laurette, FrÃdÃric
Lecomte, Laure Limongi, Ingrid Luley, Nicolas Maigret, lowMax Mar, Joachim
Montessuis, Niteffect, Jean-FranÃois Pauvros & Charles Pennequin, Phoenelai,
Plateau repas, Post Gods, Prexley, Princesse Rotative, Pupusse & Patrack,
StAnza, Lucien Suel, Nathalie Talec & Xavier Boussiron, Tsuneko Taniuchi,
Team Plastique, Kasper Toeplitz, Ultradig, Roi Vaara, Thierry Weyd, Lefevre
Jean Claude
[image: annuler par loychan]<http://www.flickr.com/photos/loychan/3435008514/>
samedi, mars 28, 2009
*new release : MANXOME on 1000+1 Tilt Records* *>****all the infections
that the sun sucks
up<http://www.lastfm.fr/music/manxome/_/all+the+infections+that+the+sun+sucks+up>
*
Hei!
i've lately published a live recording under the name of MANXOME,
with my friend Lucille Calmel on the DIY greek label 1000+1 Tilt.
I'm very happy with this record that's a really deep and spontaneous ritual,
with weird voices and hallucinated, shamanic drones and noises.
It's a limited CD-r edition with an handmade package,
You can directly contact me, or the label to order your copy (they accept
trades as well).
grtz
yannick@idiosyncratics.net
<http://www.dailymotion.com/user/loychan/video/x8sh9r_sensure_creation>
<http://www.dailymotion.com/user/loychan/video/x8rd3k_oneemail_creation>
Contenu Explicite<http://www.dailymotion.com/user/loychan/video/x8qx76_monte2_creation>
<http://www.dailymotion.com/user/loychan/video/x8sh9r_sensure_creation>
00:23
fra
sensure<http://www.dailymotion.com/user/loychan/video/x8sh9r_sensure_creation>
Par
loychan <http://www.dailymotion.com/loychan>
0 vote
*23* vues | *0* com.
<http://www.dailymotion.com/user/loychan/video/x8rd3k_oneemail_creation>
00:27
fra
One email<http://www.dailymotion.com/user/loychan/video/x8rd3k_oneemail_creation>
Par
loychan <http://www.dailymotion.com/loychan>
0 vote
*11* vues | *0* com.
<http://www.dailymotion.com/user/loychan/video/x8qx76_monte2_creation>
03:00
fra
Contenu Explicite<http://www.dailymotion.com/user/loychan/video/x8qx76_monte2_creation>
Monte2<http://www.dailymotion.com/user/loychan/video/x8qx76_monte2_creation>
<http://www.dailymotion.com/user/loychan/video/x8np7v_monte_creation>
âon devrait accepter lâesthÃtique de la confusion, le moment de dÃroute qui
est la condition pour quâÃmerge le scepticisme nÃcessaire à une pensÃe
radicale. radical -petit robert : qui tient à lâessence, au principe ; qui
vise à agir sur la cause profonde des effets quâon veut modifier. <img
class="emote_img" src="jeudis_fichiers/robot.gif"
alt=":|]"><br>:|]<br>:|]<blockquote style="border-left: 2px solid rgb(16,
16, 255); margin-left: 5px; padding-left: 5px;"><br><br><div
id="yiv206811142"><table border="0" cellpadding="0"
cellspacing="0"><tbody><tr><td style="font-family: inherit; font-style:
inherit; font-variant: inherit; font-weight: inherit; font-size: inherit;
line-height: inherit; font-size-adjust: inherit;" valign="top"><div
style="width: 600px; height: 457px; min-height: 300px;" class="photo"
id="ImageDiv"> <a rel="nofollow" target="_blank" href="
http://viewmorepics.myspace.com/index.cfm?fuseaction=viewImage&friendID=64492009&albumID=59548&imageID=40345212#a=59548&i=40345227"
id="ctl00_ctl00_cpMain_cpMain_ViewImageControl_ucImageView_PhotoNoter1_hypImageNext">
<font color="#ff0000" size="7"><b>a</b></font><img id="userImage"
src="jeudis_fichiers/l_d33910995a4f458f81edc9b335175b03.jpg" height="153"
width="200">Taisha Abelar, une sorciÃre, disait que faire l'amour avec un
homme tissait des liens indestructibles entre le vagin et la bite, comme des
fils tÃlÃpathiques<span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span><span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span><span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span><span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span><span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span><span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span><span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span><span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span><span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span><span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span><span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span><span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span><span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span><span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span><span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span><span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span><span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span><span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span><span class="signature"><img
src="jeudis_fichiers/barbarella.gif" alt="[:barbarella]"
title="[:barbarella]"></span></a><br> <br> <font size="5">jack<br> jack
bauer<br> je ne sais plus<br> rien d'un homme<br> lorsque<br> le bleu du
ciel<br> est plutÃt noir<br> Ã l'oeil /</font><br> <h2><img
src="jeudis_fichiers/lucille.gif" alt="lucille" height="342"
width="512"></h2> un oeuf à la coque +ongles longs<br> un vampire amoureux
+malÃdiction +gentil, une mutante ÃchappÃe d'un centre laboratoire militaire
accroupie au faÃte ville grande +vÃlo, un dÃtective privà psychopathe
envoÃtà +ventilateur /chaotique neutre<br> <br> <br> Ãa c'est pour dire il y
a des signes qui font mÃtre revoir la donne, pause obtempÃrer<br> <br>
l'excÃdent<br> <br> <font size="5">la pute de moi est pour<br> Ãcrire
dorÃnavant</font><br> <h4 class="desc"><font size="5"><a rel="nofollow"
target="_blank" href="http://www.links2love.com/is_it_love_2.htm" title="Ce
lien vers un site externe s'ouvrira dans une nouvelle fenÃtre ">in
love</a></font><a rel="nofollow" title="Ce lien vers un site externe
s'ouvrira dans une nouvelle fenÃtre " target="_blank" href="
http://www.meteofrance.com/FR/mameteo/prevVille.jsp?LIEUID=FR34172#"><img
alt="" src="jeudis_fichiers/p9.gif" border="0"></a></h4> <br> <br> que tu
dis<br> <br> je n'arrive plus à lire voir ce qui touche à l'obscÃne depuis
que j'ai eu le coeur directs uppercuts d'avec un<br> <br> saison 7<br> <br>
Ãa pour dire que j'essaie parfois de faire des listes titres de sÃries tÃlÃ
et que Ãa donne peutÃtre moins mauvaise haleine qu'une cascade de
pilules<br> <br> <font size="5">(<font face="Courier New" size="4">est ce
que cette nuit j'ai rÃvà d'essayer un uzzi, aprÃs tout plus maniable qu'un
ak47, recul contre hanche</font>)</font><br> <br> presser la chair
l'ossature<br> <br> (des capotes sales et des serviettes hygiÃniques usagÃes
volent dans <h1>demande-moi.com / demandemoi.com / demande-moi.fr /
demandemoi.fr / dis-moi.fr</h1> <h2>NOMS DE DOMAINE A VENDRE - DOMAIN NAMES
FOR SALE</h2> l'air dÃs que le vent souffle, parce que les gens ne sont pas
foutus de fermer leurs poubelles correctement)<br> <
a rel="nofollow" target="_blank" href="
http://viewmorepics.myspace.com/index.cfm?fuseaction=viewImage&friendID=64492009&albumID=59548&imageID=40345212#a=59548&i=40345227"
id="ctl00_ctl00_cpMain_cpMain_ViewImageControl_ucImageView_PhotoNoter1_hypImageNext"><span
class="signature"> </span> </a> <div id="NotesBox" style="width: 200px;
display: none;"> <div id="noteFieldDiv"> <input style="width: 180px; color:
rgb(153, 153, 153);" id="friendSuggestInput" class="notefield" tabindex="1"
type="text"> </div> <div id="acPlacement"> </div> <input style="display:
none;" tabindex="3" value="Enregistrer" class="buttons" id="SaveNote"
type="button"> <input tabindex="4" value="Annuler" class="buttons"
id="CancelNote" type="button"> <input id="friendId" value="0" type="hidden">
<input id="displayName" value="0" type="hidden"> </div> </div> <div
id="dvCaptionHolder" align="center"> <div id="caption" class="captionView">
<span
id="ctl00_ctl00_cpMain_cpMain_ViewImageControl_ucImageView_lblCaption"></span></div>
</div> <span id="photoViewCounts"></span> <div style="width: 600px; height:
372px; min-height: 300px;" class="photo" id="ImageDiv"> <a rel="nofollow"
target="_blank" href="
http://viewmorepics.myspace.com/index.cfm?fuseaction=viewImage&friendID=64492009&albumID=59548&imageID=40345227#a=59548&i=37894148"
id="ctl00_ctl00_cpMain_cpMain_ViewImageControl_ucImageView_PhotoNoter1_hypImageNext">
<img id="userImage"
src="jeudis_fichiers/l_d596295b507245ec87c79f8a728b789d.jpg" height="82"
width="132"><img alt="http://www.typeneu.com/content/34_negative.gif"
src="jeudis_fichiers/download_002.gif"> </a> <div id="NotesBox"
style="width: 200px; display: none;"> <div id="noteFieldDiv"> <input
style="width: 180px; color: rgb(153, 153, 153);" id="friendSuggestInput"
class="notefield" tabindex="1" type="text"> </div> <div id="acPlacement">
</div> <input style="display: none;" tabindex="3" value="Enregistrer"
class="buttons" id="SaveNote" type="button"> <input tabindex="4"
value="Annuler" class="buttons" id="CancelNote" type="button"> <input
id="friendId" value="0" type="hidden"> <input id="displayName" value="0"
type="hidden"> </div> </div> <div style="width: 600px; height: 481px;
min-height: 300px;" class="photo" id="ImageDiv"> <a rel="nofollow"
target="_blank" href="
http://viewmorepics.myspace.com/index.cfm?fuseaction=viewImage&friendID=64492009&albumID=59548&imageID=40154490#a=59548&i=40154498"
id="ctl00_ctl00_cpMain_cpMain_ViewImageControl_ucImageView_PhotoNoter1_hypImageNext">
<img id="userImage"
src="jeudis_fichiers/l_d370bdfa18d34baa884c42e7fe2cf5aa.jpg" height="229"
width="286"><font color="#ff0000" size="4">- </font></a><a rel="nofollow"
target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=184995668"><img
style="width: 18px; height: 15px;"
src="jeudis_fichiers/s_d307d2084204e01de204b90a2795b903.gif" alt="Olivier
Lecreux Performance" title="Olivier Lecreux Performance"
class="profileimagelink">me , </a><a rel="nofollow" target="_blank" href="
http://saucisse.org/mix/un.php"> un elle assise elle ma nuque ma main la vie
une toile cuisse plage douceur elle lâ</a>. BLEACH Bi, sion r. â, eindre
vacille si vous prenez des photos nous nous sommes rencontr, Â ! Doux, <div
class="blogSubject"> les escalators me conduisent toujours en enfer / en
rÃve / et j'aime Ãa<br> (<br> <div class="blogSubject"> <font
color="#ff0000">every position of desire</font> )</div> </div> <a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=184995668">Ð+0ÐâÑÐââÑÐââÑÐââ@v*Ð+&ÐÐ*ÑÐââpÐÑÐââÑÐââÑÐâââ{ÐP*ÑÐââÑÐââÑÐââÑÐââÑÐâââÐÑÐââÑÐââÑÐââÑÐââÑÐââ@G)ÑÐââÑÐââÑÐââ@>ÐÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââP5."ÑÐââÑÐââÑÐââ
Ñ#Ðc&ÑÐââÐâ/ÐfÐÐ)`ÐÐ2ÐâNâÑÐââPÐÐÑÐââÐÑ)Ð*ÑÐââ}ÑÐââÑÐââÑÐââÑÐââ
C-ÑÐââÑÐââÐÐ@Ðââ{Ð6âÑÐââÑÐââÐÑÑÐââÑÐââÑÐââÑÐâââXÐâ(âm*ÑÐââÑÐââÑÐââÑÐââÑÐâââÐÐâ-ÑÐââÑÐââÑÐââÑÐâââ+*Ðâ)pÐÐÐÐ"ÑÐââÑÐââÑÐââPÐ"
ÐÑÐââÑÐââÐâ,ÑÐââPdÐ <img src="jeudis_fichiers/download.gif"
alt="">ïïïïïïïïïïïïïïïïïïïïïïïïïïïïïïïïïïï.ÐâÐ0ÐÑÐââÑÐââÑÐââÐa)ÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââ
âÐÑÐââ0â(ÑÐâââÂÐ@Ð ÑÐââ âÐÑÐââÑÐââÑÐââpÐÐâe*ââÐÑ
ÑÐââpâÑÑÐââÑÐââÑÐââ`âÐÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââ 2ÐPq"ÑÐââÑÐââp*
ÐÐââ'ÐÐÐÑÐââÑÐâââÐ{â ÐÑÐââÑÐââÑÐââ`âÐ)
ÑÐââÑÐââÐâÑÐâââÐ'ÑÐââÑÐâââÐÐÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââ
}Ð ÑÐââÑÐââÐ:*ÑÐââÑÐââÑÐââÑÐââÑÐââ`âÑÐââÑÐââÑÐââÑÐââ`eÐp)ÑÐââÑÐââÑÐââ`
ÑÐââÑÐââÑÐââÐ9!P}%âQÐÑÐââÑÐââpâÐÑÐââpÐÐÑÐââÑÐââÐÐÑÐâââJ #ÑÐââ
:ÐÑÐââÑÐâââÐââÐ@ÐÐÑÐââÑÐââpÐ#ÑÐââÑÐââÑÐââÑÐââÑÐââ
kÐÑÐââ@âÐÑÐââ8rÑÐââÑÐââÑÐââÑÐââÑÐââ
Ñ!*ÑÐââÑÐââ`Ð)ÑÐââÑÐââÑÐââÑÐââÑÐââÑÐâââÂ!0ÐâÑÐââÑÐââÑÐââÑÐââÑÐââÐÐÐâÑÐÑÐ*ÑÐââÑÐââÑâÐ
lâPâ'0âÐ0VâÑ4*`âÐâÐ#Pâ
âÐâââÐ0b'ÐeÐ0Ð`m/jÐÑÐââÐ.*pBÐ0ÐÐâÑÐÑÐââÑÐââPtâPÐ{ÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââ*ÑÐââÑÐââÑÐââ0
âÑÐââÑÐââÑÐââÑÐââÐâÑÐRÐâ@!ÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐâââ'ÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââ@Ñ
ÑÐââÑÐââ âÐÑÐââÑÐâââ|
0âÐâ:-ÑÐââÑÐââÑÐââPwyÑÐââÑÐââââÐÐÐ#ÑÐââÑÐââÑÐââp}%ÑÐâââd
ÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââ`'ÑÐââââÐÑÐââÑÐââÑÐââÑÐââpâÐâÐPÐÑÐââÑÐââÑÐââÑÐâââ*ÑÐââÑÐââÑÐââ!#ÑÐââÑÐâââÐ
âÐ
>ââÐ+P_ÐÑÐââ3+pLâÑ*P !0Ð0mâ`f"ÑÐââÑÐââp#0âÐÑÐââÑÐââpÐ=!ÑÐââÑÐââPâÐÑÐââÐÑâÑÐââÑÐââÑÐââ`})#ÑÐââÑÐââÐâÐÐÑ
ÑÐââÑÐââÑÐââÐ# 6ââÐ*ÑÐââânÐ (ÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââ
â)PyÐÑÐââÑÐââÑÐââÑÐââÑÐââÐ7!â /ÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐ
ââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÐ`ÐÐâÐqÐÑÐââÑÐââ7â ââÑÐââââ'ÑÐââÑÐââ@â!Ñc
nÐ`uÐp-.ÐÂÐp+*ÑÐââÑâÐÑÐââÑÐââÑn(ÑÐââÑÐââÑÐââÑÐâââÐââÑâÑÐââÑ<ÐP~ÐâÐÐPÑÐÑÐââÑÐââ00ÐâS!@~'ÐâÐÑÐââÑÐââÑÐââÑÐââÑÐââ`i(ÑÐââÑ!$p
ÐÐÐÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââ0â!ÑÐâââÐÐÑÐââÑÐââ Ñ!
zÐÑÐââÑÐââ0~ÐÑÐââÑÐââÑÐââÑÐââÑÐâââÐâÑ* Ð.ââ ÑÐââÑÐââÑÐââÑÐââÑÐââ
Ð.âÑÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââpÑ"ÑÐââÑÐââÑÐââââ 0Ðââ0âÐâÐ =Ð`tÑÐââÐ
"ÑÐââÑÐââÑÐââ 0ÐÐÐÐÐâ)Ð âÐ
0â|P/ÐÑÐââÑÐâââX!ÐÐÑÐââÑÐâââl*âÐÑÑÐââÑÐââÑÐââÑÐââÐÑâ*PÐÑÑÐââÑÐâââÐ)ÑÐââÑÐââÑÐââ@Ð%ÑÐââÑÐââÐC*ÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÐiÐÑÐââÑÐââÑÐââÑÐââÑÐââ0#âââÐÑÐââ@Ð%
kÐÑÐââ âÐÑ-âÐâÐâÐ"ÑÐââÑÐââÑÐââÑÐââÑÐâââO&ÑâÐÑÐâââ{ÐÑÐââpââ
â*Ð)Ð#âÐ0FÐââÐÑÐââÑÐââÐÐ0ÐââÐÑ[,Ðâ"ÐÑ!ÑÐââÐâ(ÑÐââÑÐââ Ð.â."pÂ'uÐââÐ0Ñ
ÑÐââÑÐââÑÐâââÑ'ÑÐââÐÑ
ââyÑÐâââÐÐPnÐSÐâââÑÐââ@UÐÐ9âÐââââÐÑÐââP*âÑÐâââÐÑÐââÑÐââÐÑ
ÐÑÐÑÐââÑÐââÑÐââÑÐââ`nÐP9ÐÑÐââÑÐââÑÐâââÑÐÑÐââÐ<â
**ÑÐââÑÐââÐ;ÐÑÐââÐÑâÑÐââââÐÑÐââÑÐââÐ
â>âÑÐââ`âÐÑÐââÑÐââÑÐââââÐÑÐââÑÐââÐâÐÑÐâââÐÑÐââÑÐââÐâÐÑÐââÑ
ÑÐââÑÐââÑÐââÑÐâââ'ÑÐââÑÐââP$âÑÐââ
ÐÐÐâ*Ð<'ÑÐââÑÐââÑÐââÑÐââ0#ÑÐââPO!â.ÑÐââÑÐââÐÐâ0-*T.Ð'ÑÐââÑÐââÑÐââÑÐâââ!ÑHÐÑÐââÑÐââ`(ÐÑ)âÐÐÑÐââÑÐââÑÐââÑÐââ@ÐâÑÐââÐâ!ÑÐââÑÐââ|ÐÑÐââÑÐââÐlâÑÐââÑÐâââLÐ
ÐÐÑÐââÑÐââ â 0}%ÑÐââÑÐââÑÐâââÐÐÐÐÐ5!âwâ
ÐÐÑÐââÑÐââÑÐââÐz*ÐÐ(ÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââPd/
}!ÑÐââÑÐââÑÐÐÑÐââÑÐââÑÐâââ"âÐ*ÑÐââ âÐÑÐââÑÐââÑÐâââ â)
M*â2uÑÐââÑÐââÑÐââÑÐââÑ(P|ÐÑÐââÑÐââÑÐââÑÐââÑÐâââÐÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââpÐâââÐÑÐ
8ÐÑÐââÑÐââÑÐââ âÑâÐw Vz ]âPÑÐâÐ âp! ÐÐÑÐâââÐ*ÑÐââ@â
)*Ð:-ÑÐÑÐââÑÐââPâ,ÐâÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÐ/ÐcÐ@ ÐÑÐââÑÐââÑÐââÑ!
âÐÐ"PÐâWÐâÐÑÐââÑÐââ âÐÐa-Ñâ `sâ?# âÐÑÐââÑÐââÑÐââÑÐââ
âÐ@â'âkâÑÐââ@â*ÑÐââÑÐââ`ÐÐÑÐââÐl(ÑÐââÑÐââ0Ð!ÑÐââÑÐâââl(ÑÐââÑÐââ@ÐâÑ
ÑÐââÐÐ0"ÐÐÐ[âÐ*ÑÐââpÐ â*Ð># ââ
Ð`ÐÐÐÑ#ÐâÐÑÐââÐÐÑÐââÑÐââÑÐââ`ÐÐÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââ0ÐÑÐââÑÐââââ*ÑÐ</a><a
rel="nofollow" target="_blank" href="
http://images.google.be/imgres?imgurl=http://wombatairlines.files.wordpress.com/2007/08/11.jpg&imgrefurl=http://wombatairlines.wordpress.com/&h=463&w=450&sz=60&hl=fr&start=11&tbnid=X3CkpzSW2qEU4M:&tbnh=128&tbnw=124&prev=/images?q%3Dsilence%2Bis%2Bsexy%26gbv%3D2%26svnum%3D10%26hl%3Dfr%26client%3Dfirefox-a%26rls%3Dorg.mozilla:fr:official_s%26sa%3DG"><img
style="border: 1px solid ;" src="jeudis_fichiers/images.jpg" height="128"
width="124"></a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=184995668">ââP>âÑÐââ@ÐÐÑÐâââ
ÐâDÐÑÐââÑÐââÐq"H# â
ÐÑ*ÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââ0iâÑÐââÑÐââÑÐââÑÐââ0&ÑÐââÑÐââÐ"âÑÐââ@ÐÑÐâââyÐÑÐââ
{ÐÑÐââÑÐââÑÐâââ^ÐÑÐâââ *ÑÐâââR,ÑÐââ0s"
j(â*ÑÐââÑÐââÑÐââÑÐââpÂÐâ$PÐP6)PâÑÐââÑÐââÑÐââÑÐââÑÐââÑ;Ð
sâÑÐââÐ~(âÐÑÐââÑÐââÑÐââÑÐââ`/ â ÐââÐ wÐ@ ÐÑÐââÑÐââÑÐâââB+Ââ
&ÑÐââÑÐââÑÐââÑÐââÐÐ
ÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐââÑÐâââbÐÑÐââÑÐââÑÐââÐÐÑÐââÑÐââÑÐââÑÐââ
sÐÑÐââÑÐââÑÐââÑÐ-ÑÐââ ÑÐ@âÐ0âÐÐ7|>#âr,Ñq'ÑÐââpÐ*ÐÐÐ?ÐÑÐââÑÐââÐâÐÑÐâ</a><a
rel="nofollow" target="_blank" href="
http://viewmorepics.myspace.com/index.cfm?fuseaction=viewImage&friendID=64492009&albumID=59548&imageID=40154490#a=59548&i=40154498"
id="ctl00_ctl00_cpMain_cpMain_ViewImageControl_ucImageView_PhotoNoter1_hypImageNext"><br>
<font color="#ff0000" size="4"> </font></a><font color="#ff0000" size="4"><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=170931941"
id="ctl00_Main_ctl00_UserFriends1_FriendRepeater_ctl08_friendImageLink"><img
alt=""
src="jeudis_fichiers/s_ba434ab33e7507b8607ea4db92a27e7d.jpg"></a></font><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=170931941"
id="ctl00_Main_ctl00_UserFriends1_FriendRepeater_ctl08_friendImageLink"><font
color="#ff0000" size="4"><br></font><img
src="jeudis_fichiers/l_efd5da5fc4a5742d2a08273fba8f49b4.gif" alt=""
height="200" width="200"></a> <div id="NotesBox" style="width: 200px;
display: none;"> <div id="noteFieldDiv"> <input style="width: 180px; color:
rgb(153, 153, 153);" id="friendSuggestInput" class="notefield" tabindex="1"
type="text"> </div> <div id="acPlacement"> </div> <input style="display:
none;" tabindex="3" value="Enregistrer" class="buttons" id="SaveNote"
type="button"> <input tabindex="4" value="Annuler" class="buttons"
id="CancelNote" type="button"> <input id="friendId" value="0" type="hidden">
<input id="displayName" value="0" type="hidden"> </div> </div> <div
style="width: 445px; height: 420px; min-height: 300px;" class="photo"
id="ImageDiv"> <a rel="nofollow" target="_blank" href="
http://viewmorepics.myspace.com/index.cfm?fuseaction=viewImage&friendID=64492009&albumID=59548&imageID=40154498#a=59548&i=40154735"
id="ctl00_ctl00_cpMain_cpMain_ViewImageControl_ucImageView_PhotoNoter1_hypImageNext">
<img id="userImage"
src="jeudis_fichiers/l_efca132193b144749e267607606596b0.jpg" height="199"
width="211"></a><br> <font style="font-weight: bold;" size="4"><span
style="color: rgb(128, 0, 0);"><font size="5">POUR RIEN<br>ENTRE DEUX
MOUVEMENTS<br>IL DORT / IL A CET ÃVANOUISSEMENT UN MEC DANS LA RUE UN MEC
DANS LA RUE /UN MEC DANS LA RUE UN / IL DORT / IL ÃTE SES LUNETTES / ET IL
DORT / CHUTE Ã PLAT DOS / </font></span></font><a rel="nofollow"
target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=184995668"><img
src="jeudis
_fichiers/s_d307d2084204e01de204b90a2795b903.gif" alt="Olivier Lecreux
Performance" title="Olivier Lecreux Performance"
class="profileimagelink"></a><font style="font-weight: bold;" size="4"><span
style="color: rgb(128, 0, 0);"><font size="5">ENTRE DEUX / CHUTE / POUR RIEN
/ ENTRE / ENTRE DEUX MOUVEMENTS / UN FILM DE ZOMBIES / UNE MAISON PAUMÃE AU
MILIEU DES BOIS UNE MAISON ENTOURÃE DE ZOMBIES / SOUS LES AISSELLES /
RELEVER LE CORPS / AVANT BRAS SOUS LES AISSELLES / APPEL
</font></span></font><br> <a rel="nofollow" target="_blank" href="
http://viewmorepics.myspace.com/index.cfm?fuseaction=viewImage&friendID=64492009&albumID=59548&imageID=40154498#a=59548&i=40154735"
id="ctl00_ctl00_cpMain_cpMain_ViewImageControl_ucImageView_PhotoNoter1_hypImageNext">
</a> <div id="NotesBox" style="width: 200px; display: none;"> <div
id="noteFieldDiv"> <input style="width: 180px; color: rgb(153, 153, 153);"
id="friendSuggestInput" class="notefield" tabindex="1" type="text"> </div>
<div id="acPlacement"> </div> <input style="display: none;" tabindex="3"
value="Enregistrer" class="buttons" id="SaveNote" type="button"> <input
tabindex="4" value="Annuler" class="buttons" id="CancelNote" type="button">
<input id="friendId" value="0" type="hidden"> <input id="displayName"
value="0" type="hidden"> </div> </div> <a rel="nofollow" target="_blank"
href="
http://viewmorepics.myspace.com/index.cfm?fuseaction=viewImage&friendID=64492009&albumID=59548&imageID=40154735#a=59548&i=40345212"
id="ctl00_ctl00_cpMain_cpMain_ViewImageControl_ucImageView_PhotoNoter1_hypImageNext">
<img id="userImage"
src="jeudis_fichiers/l_8ba9064e57614a4088b00ae8f0a59bfd.jpg"></a><a
rel="nofollow" target="_blank" href="
http://viewmorepics.myspace.com/index.cfm?fuseaction=viewImage&friendID=64492009&albumID=59548&imageID=40154735#a=59548&i=40345212"
id="ctl00_ctl00_cpMain_cpMain_ViewImageControl_ucImageView_PhotoNoter1_hypImageNext">
<img id="userImage"
src="jeudis_fichiers/l_8ba9064e57614a4088b00ae8f0a59bfd.jpg"></a><a
rel="nofollow" target="_blank" href="
http://viewmorepics.myspace.com/index.cfm?fuseaction=viewImage&friendID=64492009&albumID=59548&imageID=40154735#a=59548&i=40345212"
id="ctl00_ctl00_cpMain_cpMain_ViewImageControl_ucImageView_PhotoNoter1_hypImageNext">
<img id="userImage"
src="jeudis_fichiers/l_8ba9064e57614a4088b00ae8f0a59bfd.jpg"></a><a
rel="nofollow" target="_blank" href="
http://viewmorepics.myspace.com/index.cfm?fuseaction=viewImage&friendID=64492009&albumID=59548&imageID=40154735#a=59548&i=40345212"
id="ctl00_ctl00_cpMain_cpMain_ViewImageControl_ucImageView_PhotoNoter1_hypImageNext">
<img id="userImage"
src="jeudis_fichiers/l_8ba9064e57614a4088b00ae8f0a59bfd.jpg"></a><br> Oui
simplement m'Ãcouterâsans excusation, ni accusation, sans dÃpossession de ma
parole, sans tentative d'appropriation de ce que je te dis.<br> Ecoute,
Ãcoute-moi quelque fois !! Tout ce que je te demande, c'est de
m'Ãcouter.<br> comme toujours, je te demande pardon Si je te demande de
vivre auprÃs de moi<br> C'est que mon coeur tremble Chaque fois que je te
vois Si je te demande de partager mes jours C'est que d'Ãtre ensemble J'ai
retrouvà l'amour Par dÃfaut je t'aime ... et je te demande en mariage Je
tâaime ma lumiÃre et je veux tu sois ma femme pour lâÃternità â.. je tâaime
je tâaime et je tâaime â. .......dis moi wii â.nul ne tâaimera comme moi
ââ.Pour le mal que j'ai fait Je te demande pardon {x3} Pour notre bel amour
Je te demande pardon {x3} Â Est-ce que je te demande si ta grand-mÃre fait
du vÃlo ? Â Est-ce que je te demande la couleur de tes chaussettes ? Est-ce
que je t'ai demandà quelque chose ? je te demande un service : 1- je reÃois
pas des emails comme avant de esp Maroc POURQUOI<br> <img
src="jeudis_fichiers/download.jpg" alt=""><a rel="nofollow" target="_blank"
href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://www.flickr.com/photos/lucille_calmel/522119858/" title="Photo
Sharing"><img src="jeudis_fichiers/522119858_0382f55cd7.jpg" alt="ssssssss"
height="500" width="375"></a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601"><img
src="jeudis_fichiers/spacer.gif" alt="" border="0" height="1"
width="30"></a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">
</a> <div class="blogSubject"> SCANSION SCOMPILATOIRE DE SCONNERIES </div>
<a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601
">X.</a&
gt;<a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=78583601">X.</a><br>
(b) Num bow (w) HA (m) ... )<br> (a) (u,v) : ** : Xc tr Y (( )<br>
(z) ! ... . Irr Y : TTTTTT $<br> (y) (X w (h) ee ( ( * ) ( , :
/<br> (x) F* #i **-&lem... ....i'i'i'<br> (w) n (dG) : '0'
@###' d<br> (v) " "<a rel="nofollow"
target="_blank" href="http://www.flickr.com/photos/lucille_calmel/520094127/"
title="Photo Sharing"><img src="jeudis_fichiers/520094127_469da13812.jpg"
alt="hhhhhhhhhhhhhh" height="91" width="370"></a><br> (u) n (x) " Ymaj.0 :
!. f ( ) mii.<br> <a rel="nofollow" target="_blank" href="
http://images.google.fr/imgres?imgurl=http://www.antraxja.iweb.pl/font/fonty/e/extasy.gif&imgrefurl=http://antraxja-fonts.iweb.pl/index.php%3Fshow%3Dshape%26litera%3Db%26od%3D2%26&h=67&w=500&sz=8&tbnid=4VdcNX6KDgbO7M:&tbnh=17&tbnw=127&hl=fr&start=525&prev=/images%3Fq%3Dextasy%26start%3D520%26svnum%3D10%26hl%3Dfr%26lr%3D%26sa%3DN"
title="Ce lien vers un site externe s'ouvrira dans une nouvelle fenÃtre
"><img src="jeudis_fichiers/images_024.jpg" height="17" width="127"></a><a
rel="nofollow" target="_blank" href="
http://images.google.fr/imgres?imgurl=http://www.antraxja.iweb.pl/font/fonty/e/extasy.gif&imgrefurl=http://antraxja-fonts.iweb.pl/index.php%3Fshow%3Dshape%26litera%3Db%26od%3D2%26&h=67&w=500&sz=8&tbnid=4VdcNX6KDgbO7M:&tbnh=17&tbnw=127&hl=fr&start=525&prev=/images%3Fq%3Dextasy%26start%3D520%26svnum%3D10%26hl%3Dfr%26lr%3D%26sa%3DN"
title="Ce lien vers un site externe s'ouvrira dans une nouvelle fenÃtre
"><img src="jeudis_fichiers/images_024.jpg" height="17" width="127"></a><a
rel="nofollow" target="_blank" href="
http://images.google.fr/imgres?imgurl=http://www.antraxja.iweb.pl/font/fonty/e/extasy.gif&imgrefurl=http://antraxja-fonts.iweb.pl/index.php%3Fshow%3Dshape%26litera%3Db%26od%3D2%26&h=67&w=500&sz=8&tbnid=4VdcNX6KDgbO7M:&tbnh=17&tbnw=127&hl=fr&start=525&prev=/images%3Fq%3Dextasy%26start%3D520%26svnum%3D10%26hl%3Dfr%26lr%3D%26sa%3DN"
title="Ce lien vers un site externe s'ouvrira dans une nouvelle fenÃtre
"><img src="jeudis_fichiers/images_024.jpg" height="17" width="127"></a><br>
<font style="color: rgb(192, 0, 0); font-weight: bold;" size="7"><a
rel="nofollow" target="_blank" href="
http://images.google.fr/imgres?imgurl=http://www.filmarchiv.at/events/machaty/pics/extase.jpg&imgrefurl=http://www.filmarchiv.at/events/machaty/extase.htm&h=284&w=300&sz=7&tbnid=pqvhJf1G7FZVnM:&tbnh=105&tbnw=111&hl=fr&start=3&prev=/images%3Fq%3Dextase%26svnum%3D10%26hl%3Dfr%26lr%3D%26sa%3DG"
title="Ce lien vers un site externe s'ouvrira dans une nouvelle fenÃtre
">let's go to bordel</a><br> </font><a rel="nofollow" target="_blank" href="
http://images.google.fr/imgres?imgurl=http://www.antraxja.iweb.pl/font/fonty/e/extasy.gif&imgrefurl=http://antraxja-fonts.iweb.pl/index.php%3Fshow%3Dshape%26litera%3Db%26od%3D2%26&h=67&w=500&sz=8&tbnid=4VdcNX6KDgbO7M:&tbnh=17&tbnw=127&hl=fr&start=525&prev=/images%3Fq%3Dextasy%26start%3D520%26svnum%3D10%26hl%3Dfr%26lr%3D%26sa%3DN"
title="Ce lien vers un site externe s'ouvrira dans une nouvelle fenÃtre
"><img src="jeudis_fichiers/images_024.jpg" height="17" width="127"></a><a
rel="nofollow" target="_blank" href="
http://images.google.fr/imgres?imgurl=http://www.antraxja.iweb.pl/font/fonty/e/extasy.gif&imgrefurl=http://antraxja-fonts.iweb.pl/index.php%3Fshow%3Dshape%26litera%3Db%26od%3D2%26&h=67&w=500&sz=8&tbnid=4VdcNX6KDgbO7M:&tbnh=17&tbnw=127&hl=fr&start=525&prev=/images%3Fq%3Dextasy%26start%3D520%26svnum%3D10%26hl%3Dfr%26lr%3D%26sa%3DN"
title="Ce lien vers un site externe s'ouvrira dans une nouvelle fenÃtre
"><img src="jeudis_fichiers/images_024.jpg" height="17" width="127"></a><a
rel="nofollow" target="_blank" href="
http://images.google.fr/imgres?imgurl=http://www.antraxja.iweb.pl/font/fonty/e/extasy.gif&imgrefurl=http://antraxja-fonts.iweb.pl/index.php%3Fshow%3Dshape%26litera%3Db%26od%3D2%26&h=67&w=500&sz=8&tbnid=4VdcNX6KDgbO7M:&tbnh=17&tbnw=127&hl=fr&start=525&prev=/images%3Fq%3Dextasy%26start%3D520%26svnum%3D10%26hl%3Dfr%26lr%3D%26sa%3DN"
title="Ce lien vers un site externe s'ouvrira dans une nouvelle fenÃtre
"><img src="jeudis_fichiers/images_024.jpg" height="17"
width="127"></a>.<br> .<br> .<br> .<br> .<br> .<br> <tt> en ce moment, je
pÃse le racket entre les temps d'un peu de chair larguÃe lestÃe... le coÃt
de la transparence<br> la tÃte occupÃe net au filet net à doubler la
dimension du corps proportions toutes gardÃes et le squelette s'effondre...
l'armature multipliÃe ne correspond pas<br> il est question d'Ãchelle<br> Ã
contre, quelques amis voyageurs aÃriens me confient avoir perdu toute notion
de perspective dÃs qu'il s'agissait d'apprÃcier la distance d'un nuage...
six ou <font size="5">six cents mÃtres<br> il y a des accidents<br> que vous
dÃcoupiez une livre ou un milligramme de chair, le sang coulera<br> Il y a
quelques mois, mon chien est mort</font><br> </tt><span style="color:
rgb(192, 0, 0);">- - - ---- -- -- --- - -- --- - - -- -- - - ---- - - -- -
- - - - </span><br style="color: rgb(192, 0, 0);"> <span style="color:
rgb(192, 0, 0);"> - -- - -</span><br style="color: rgb(192, 0, 0);"> <span
style="color: rgb(192, 0, 0);"> -</span><br style="color: rgb(192, 0, 0);">
<span style="color: rgb(192, 0, 0);"> - </span><br style="color: rgb(192, 0,
0);">
<span style="color: rgb(192, 0, 0);"> - -- --- -- -</span><br
style="color: rgb(192, 0, 0);"> <span style="color: rgb(192, 0, 0);">
</span><br style="color: rgb(192, 0, 0);"> <span style="color: rgb(192, 0,
0);"> - -</span><br style="color: rgb(192, 0, 0);"> <span style="color:
rgb(192, 0, 0);"> -</span><br style="color: rgb(192, 0, 0);"> <span
style="color: rgb(192, 0, 0);"> - - - ---- - - - --- -</span><a
rel="nofollow" target="_blank" href="
http://images.google.be/imgres?imgurl=http://img.tchatcheblog.com/articleimage.ashx%3Fid%3D4514963%26w%3D400%26h%3D400&imgrefurl=http://gothcorejca.tchatcheblog.com/%3Fp%3D9&h=400&w=379&sz=13&hl=fr&start=78&tbnid=Bmh0WibC6t29LM:&tbnh=124&tbnw=117&prev=/images%3Fq%3Dmutile%26start%3D60%26ndsp%3D20%26svnum%3D10%26hl%3Dfr%26lr%3D%26client%3Dfirefox-a%26rls%3Dorg.mozilla:fr:official_s%26sa%3DN"
title="Ce lien vers un site externe s'ouvrira dans une nouvelle fenÃtre
"><img style="border: 1px solid ;" src="jeudis_fichiers/images_004.jpg"
height="124" width="117"></a><font style="color: rgb(192, 0, 0);"
size="3"><span style="font-weight: bold;">TT T TD TDTD TD TD TDTDTT TDT DT
DT DT DTD RDTTDTD TTD DTT DTDT DTTDTDTTDTT DTD TD TTD TD TTDT DTD TTDD TD
TTD TDT DTDT DTD T DTD TD TDTTD TD TDTTD DA GDATGGTA GTATG GATAG GAGATG
AAGGAT GTATGATGCTACGTCA TGCTCAC GTC AGCTG CATACGGTCAG TACGTCAGACTGATCGACT
GACTGACTGTCAGACT GAC TAGCTAC GT ACGTCAGCAGGTACGACTGCATGCATGCATTGC ATCAG T
TGCATG ATC GACT GTCATAGC GACG TGCA T CAG TCA GAC TG TACGT AC GTGAC G TAC
GTCAG G TACG TG CAG TACG TG CAGCAG ACGT TG AC GTACG TT ACG TACG TGT CAG TACG
TG CTA TGCAG TACG G TCA GTAC TGT CGA GTCATG ACTGTG CAGTACG TACTTG CA TGT
ATCAGT ATCGT ACTG TG GTCAGT AC TTCAG ACTGACGTTGAGCTGTCATGCATCAG TC GCTFGT
GDE T TTTGC TC TGGCTX GZGDZT I WILL DECEIVE YOU WILL PLAY III I I I I I
I II II I II I WW IIW LLIWLI </span></font><br style="color: rgb(192, 0,
0);"> <br style="color: rgb(192, 0, 0);"> <span style="color: rgb(192, 0,
0);"> - --- --</span><br style="color: rgb(192, 0, 0);"> <span style="color:
rgb(192, 0, 0);"> -</span><br style="color: rgb(192, 0, 0);"> <span
style="color: rgb(192, 0, 0);"> --</span><br style="color: rgb(192, 0, 0);">
<span style="color: rgb(192, 0, 0);"> --- -- - - -- - --- - -- -</span><br
style="color: rgb(192, 0, 0);"> <span style="color: rgb(192, 0, 0);"> --- -
-- --- </span><br style="color: rgb(192, 0, 0);"> <br style="color: rgb(192,
0, 0);"> <span style="color: rgb(192, 0, 0);"> - </span><br style="color:
rgb(192, 0, 0);"> <span style="color: rgb(192, 0, 0);"> -</span><br> <a
rel="nofollow" target="_blank" href="
http://www.myrtilles.org/lu/a%20flash/writing.jpg" title="Ce lien vers un
site externe s'ouvrira dans une nouvelle fenÃtre ">writing</a><a
rel="nofollow" target="_blank" href="
http://www.myrtilles.org/lu/a%20flash/writing.jpg" title="Ce lien vers un
site externe s'ouvrira dans une nouvelle fenÃtre ">writing</a><a
rel="nofollow" target="_blank" href="
http://www.myrtilles.org/lu/a%20flash/writing.jpg" title="Ce lien vers un
site externe s'ouvrira dans une nouvelle fenÃtre ">writing</a><a
rel="nofollow" target="_blank" href="
http://www.myrtilles.org/lu/a%20flash/writing.jpg" title="Ce lien vers un
site externe s'ouvrira dans une nouvelle fenÃtre ">writing</a><a
rel="nofollow" target="_blank" href="
http://www.myrtilles.org/lu/a%20flash/writing.jpg" title="Ce lien vers un
site externe s'ouvrira dans une nouvelle fenÃtre ">writing</a><a
rel="nofollow" target="_blank" href="
http://www.myrtilles.org/lu/a%20flash/writing.jpg" title="Ce lien vers un
site externe s'ouvrira dans une nouvelle fenÃtre ">writing</a><a
rel="nofollow" target="_blank" href="
http://www.myrtilles.org/lu/a%20flash/writing.jpg" title="Ce lien vers un
site externe s'ouvrira dans une nouvelle fenÃtre ">writing</a><a
rel="nofollow" target="_blank" href="
http://www.myrtilles.org/lu/a%20flash/writing.jpg" title="Ce lien vers un
site externe s'ouvrira dans une nouvelle fenÃtre ">writing</a><a
rel="nofollow" target="_blank" href="
http://www.myrtilles.org/lu/a%20flash/writing.jpg" title="Ce lien vers un
site externe s'ouvrira dans une nouvelle fenÃtre ">writing</a><a
rel="nofollow" target="_blank" href="
http://www.myrtilles.org/lu/a%20flash/writing.jpg" title="Ce lien vers un
site externe s'ouvrira dans une nouvelle fenÃtre ">writing</a><a
rel="nofollow" target="_blank" href="
http://www.myrtilles.org/lu/a%20flash/writing.jpg" title="Ce lien vers un
site externe s'ouvrira dans une nouvelle fenÃtre ">writing</a><br> je rÃve
avoir deux orgasmes sans attouchements puis dans le rÃve je me rÃveille sur
les genoux d'audrey un autre alors dans le rÃve je raconte la chose (le rÃve
dans le rÃve et le rÃveil dans le rÃve) Ã sonia et passe le temps dans le
rÃve à me souvenir de Ãa pour Ãviter de focaliser sur des anecdotes<img
src="jeudis_fichiers/yeahopen.gif" class="desc-pic" alt=""><br> <span
style="color: rgb(0, 255, 255); font-weight: bold;">/ je ne semble pas me
tailler les veines, je dis mes veines sont taillÃes, je n'ai pas de couteau,
je me scarifie / on la retrouve dans un fossà entailles hÃmatomes robe
retroussÃe / elle revient à elle / on n'en sait pas plus / elle est
accroupie sur un promontoire à insulter hurlante / elle est une autre / une
autre en impermÃable bleugris latex avec un pgp sur tempe / elle est une
autre / une autre transfÃrÃe reine d'un quelconque shakespeare, ses mots
fabriquent et repoussent lui en murs monstres / elle rend l'air / elles sont
une autre / une balle dans le coeur / effet de cinÃma poudre percuteur poche
de sang plaque contre sein /</span> <span style="color: rgb(192, 0, 0);
font-weight: bold;">elles ne sont plus que l'entour, la tempÃrature du corps
est devinÃe en fonction de la lente continuità du mouvement / faire &
dÃfaire / le moment-mÃme oà l'Ãlastique large du pantalon de soie pointe la
suspension par l'accoup au rein / elle est au sol à baver langue tirÃe
globes occulaires traÃant le verbe / l'insecte carapace sur dos d'elle /
retire son tampax elle bave d'oà elle bave son corps bruit / elle
rÃflÃchit<br> <br> </span><a rel="nofollow" class="l" target="_blank" href="
http://www.imdb.com/title/tt0319531/" title="Ce lien vers un site externe
s'ouvrira dans une nouvelle fenÃtre ">I'll Sleep When <b>I'm
Dead</b></a><br> <pre><img
src="jeudis_fichiers/l_610adf8f5eff677494a69213da64abac.gif"></pre> <br> <a
rel="nofollow" class="l" target="_blank" href="
http://www.amazon.fr/Im-Not-Dead-Pink/dp/B000ENUYLI" title="Ce lien vers un
site externe s'ouvrira dans une nouvelle fenÃtre "><b>I'm</b> Not
<b>Dead</b></a><br> <br> <a rel="nofollow" class="l" target="_blank" href="
http://fuckimdead.noescaperecords.com/" title="Ce lien vers un site externe
s'ouvrira dans une nouvelle fenÃtre ">FUCK...<b>I'M DEAD</b></a><br> <br> <a
rel="nofollow" class="l" target="_blank" href="
http://www.geocities.com/fukimdead/" title="Ce lien vers un site externe
s'ouvrira dans une nouvelle fenÃtre ">FUCK...<b>I'M DEAD</b></a><br> <br> <a
rel="nofollow" class="l" target="_blank" href="
http://www.zestory.com/fr/actualites/cinema-en-salle/050704-i-ll-sleep-when-i-m-dead.htm"
title="Ce lien vers un site externe s'ouvrira dans une nouvelle fenÃtre
">I'll sleep when <b>i'm dead</b></a><br> <br> <a rel="nofollow" class="l"
target="_blank" href="http://www.fnac.com/shelf/Article.asp?PRID=1821799"
title="Ce lien vers un site externe s'ouvrira dans une nouvelle fenÃtre
"><b>I'm</b> not <b>dead</b></a><br> <br> <a rel="nofollow" class="l"
target="_blank" h
ref="http://www.ciao.fr/Pink_I_m_not_dead__925460" title="Ce lien vers un
site externe s'ouvrira dans une nouvelle fenÃtre "><b>I'm</b> not
<b>dead</b></a><br> <br> <a rel="nofollow" class="l" target="_blank" href="
http://www.fnacmusic.com/album/8c8dba54-0716-4681-9405-c268932a2170.aspx"
title="Ce lien vers un site externe s'ouvrira dans une nouvelle fenÃtre
"><b>I'm</b> Not <b>Dead</b></a><br> <br> <a rel="nofollow" class="l"
target="_blank" href="
http://www.apple.com/trailers/paramount_classics/illsleepwhenimdead.html"
title="Ce lien vers un site externe s'ouvrira dans une nouvelle fenÃtre
">I'll Sleep When <b>I'm Dead</b></a><br> <br> <a rel="nofollow" class="l"
target="_blank" href="http://www.bide-et-musique.com/song/5848.html"
title="Ce lien vers un site externe s'ouvrira dans une nouvelle fenÃtre
">That's the way (I like it)</a><br> <br> <a rel="nofollow" class="l"
target="_blank" href="http://forums.hexus.net/archive/index.php/t-579.html"
title="Ce lien vers un site externe s'ouvrira dans une nouvelle fenÃtre
"><b>I'm dead</b> lucky</a><br> <br> <a rel="nofollow" class="l"
target="_blank" href="http://www.inertramblings.com/2003/09/14/im-dead-sexy/"
title="Ce lien vers un site externe s'ouvrira dans une nouvelle fenÃtre
">Iâm <b>dead</b> sexy!</a><font size="-1"> <br><br></font><a rel="nofollow"
class="l" target="_blank" href="
http://www.threeyearsofhell.com/archive/000315.php" title="Ce lien vers un
site externe s'ouvrira dans une nouvelle fenÃtre ">OK, <b>I'm dead</b>
tired</a><br> <br> <a rel="nofollow" class="l" target="_blank" href="
http://www.swearing.org/photos/halloween-20041030/halloween-20041030-Pages/Image3.html"
title="Ce lien vers un site externe s'ouvrira dans une nouvelle fenÃtre
"><b>I'm dead</b> classy, me</a><br> <br> <a rel="nofollow" class="l"
target="_blank" href="http://www.newsfilter.org/photos/index.php?id=29867"
title="Ce lien vers un site externe s'ouvrira dans une nouvelle fenÃtre
"><b>I'm dead</b> sexy I am!!!</a><br> <br> <div><a rel="nofollow" class="l"
target="_blank" href="http://www.cesspit.net/drupal/node/1509" title="Ce
lien vers un site externe s'ouvrira dans une nouvelle fenÃtre "><b>Dead</b>
end</a><br> <a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><br> <a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><br> <a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><br> <font style="color: rgb(192, 0, 0);" size="3"><span
style="font-weight: bold;">out of<br>http<br></span></font><a rel="nofollow"
target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><br> <a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><br> <img src="jeudis_fichiers/spacer.gif" alt="" border="0"
height="1" width="30"> <br> ... (ellipse) <br> </div> <a rel="nofollow"
target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=97685810"><img
style="width: 472px; height: 17px;" src="jeudis_fichiers/1038998028_s.jpg"
alt=""></a> ... j'explique la consommation de la viande ... addition surtout
nous sommes embarquÃs remplacer par chacun sa place sa ogre à panser rouge
grumeau le plat est composà persil viande mÃlasse brune viande persil à la
guerre c'est panser liquide bord cils le pansà d
e ce qui (verbe Ãtre au passà compose ... j'explique la consommation de la
viande j'explique ... la consommation ... addition surtout nous sommes
embarquÃs remplacer par chacun sa place sa ogre à panser rouge grumeau le
plat est composà persil viande mÃlasse brune viande persil à la guerre c'est
panser liquide bord cils le pansà de ce qui (verbe Ãtre au passà compose ...
j'explique ... animaux à disposition en riant dent noircies jaunes c'est le
dualisme qu'on Ãradique niveau dents plantÃs dans la viande du rÃel je peux
avoir la rÃponse dÃfinitive se disent les menottÃs d'en face pourtour de
chÃmage de masse hop on va ... j' ...<br> <br> ... question, la collection,
l'autre viande masse toujours le cadavre au fond en soi l'Ãclat du,
question, et ... / les escaliers et les pronoms possessifs / le dÃsastre /
le dÃsastre / j'aime pas qu'on viande / qu'on viande connement et de haut /
les escaliers et les pronoms possessifs / les pronoms / (le tu, il , elle ,
nous vous tuent ... de la viande ... consciencieux) Wij zijn keurig. (nous
sommes consciencieux) Wij eten koeienvlees. (eten = mangeons / koeien =
vache / vlees = viande) Zij eet varkensvlees. (varken = cochon) Hij eet lam.
(lam = de l'agneau) Wij eten vis. (vis = du poisson) Vis is moeilijk ...
j'explique ... l'ovule en terrasse c'est la farce la farce en flÃche Ãtre
viande en flÃche Ãtre viande d'Ãtre mÃre de se savoir Ãtre mÃre ... lac
caillasse grouille là or q humus m erde ou barbouillis de viande je veux je
mÃche mange je plume menton plein ici de là bouffer ...<br> <br> <a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105383696"><img
style="width: 27px; height: 27px;"
src="jeudis_fichiers/s_50561773499f86979e0b43b3a07ada6c.png" alt=""></a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105383696"><img
style="width: 27px; height: 27px;"
src="jeudis_fichiers/s_50561773499f86979e0b43b3a07ada6c.png" alt=""></a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105383696"><img
style="width: 27px; height: 27px;"
src="jeudis_fichiers/s_50561773499f86979e0b43b3a07ada6c.png" alt=""></a>
Durant plusieurs semaines, j'ai volà de riches morceaux de viande dans un
supermarchà et je les ai conservÃs au frais, avant de les jeter sur une
autoroute ... sous les roues des voitures <a rel="nofollow" target="_blank"
href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105383696"><img
style="width: 27px; height: 27px;"
src="jeudis_fichiers/s_50561773499f86979e0b43b3a07ada6c.png" alt=""></a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105383696"><img
style="width: 27px; height: 27px;"
src="jeudis_fichiers/s_50561773499f86979e0b43b3a07ada6c.png" alt=""></a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105383696"><img
style="width: 27px; height: 27px;"
src="jeudis_fichiers/s_50561773499f86979e0b43b3a07ada6c.png" alt=""></a><br>
<a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105745077">ÂÂÂÂÂÂÂÂÂ..</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105745077">ÂÂÂÂÂÂÂÂÂ..</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105745077">ÂÂÂÂÂÂÂÂÂ..</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105745077">ÂÂÂÂÂÂÂÂÂ..</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105745077">ÂÂÂÂÂÂÂÂÂ..</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105745077">ÂÂÂÂÂÂÂÂÂ..</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105745077">ÂÂÂÂÂÂÂÂÂ..</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105745077">ÂÂÂÂÂÂÂÂÂ..</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105745077">ÂÂÂÂÂÂÂÂÂ..</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105745077">ÂÂÂÂÂÂÂÂÂ..</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105745077">ÂÂÂÂÂÂÂÂÂ..</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105745077">ÂÂÂÂÂÂÂÂÂ..</a><a
rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=105745077">ÂÂÂÂÂÂÂÂÂ..</a><br>
<a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target=
"_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je
jamais..</a><a rel="nofollow" target="_blank" href="
http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile&friendid=108450610">Je</a><br><a
rel="nofollow" style="color: rgb(120, 90, 118);" id="link28" target="_blank"
href="http://hallucinet.online.fr/IMG/random/anim-heartav.gif"
title="anim-heartav.gif - Up'ed "><img
src="jeudis_fichiers/anim-heartav.gif" class="preview" border="0"
height="100"></a><br> <br> ... En cache - Pages similaires supplÃment
supplÃment+viande vs attitude attitude+poubelle [PDF] GENRES ET VIANDES :
VERS UN Â TROISIÃME SEXE Â? Format de fichier: PDF/Adobe Acrobat ...<br>
<br> <div style="padding-top: 0pt; padding-bottom: 0pt;" id="rightpink">
<form target="_blank" name="form1" method="post" action="
http://radiowne.org/chat/login.php" onsubmit="return
theMainWindow.showFormWarning(this)"> <div><input class="input" name="u"
type="text"><input name="Submit" class="spip_bouton" value="OK"
type="submit"> </div> </form> </div> <div style="padding-top: 0pt;
padding-bottom: 0pt;" id="rightpink"> <form target="_blank" name="form1"
method="post" action="http://radiowne.org/chat/login.php" > <div><input
class="input" name="u" type="text"><input name="Submit" class="spip_bouton"
value="OK" type="submit"> </div> </form> </div> <div style="padding-top:
0pt; padding-bottom: 0pt;" id="rightpink"> <form target="_blank"
name="form1" method="post" action="http://radiowne.org/chat/login.php" >
<div><input class="input" name="u" type="text"><input name="Submit"
class="spip_bouton" value="OK" type="submit"> </div> </form> </div> <div
style="padding-top: 0pt; padding-bottom: 0pt;" id="rightpink"> <form
target="_blank" name="form1" method="post" action="
http://radiowne.org/chat/login.php" > <div><input class="input" name="u"
type="text"><input name="Submit" class="spip_bouton" value="OK"
type="submit"> </div> </form> </div> <div style="padding-top: 0pt;
padding-bottom: 0pt;" id="rightpink"> <form target="_blank" name="form1"
method="post" action="http://radiowne.org/chat/login.php" > <div><input
class="input" name="u" type="text"><font color="#ff0000">Dans <i><a
rel="nofollow" target="_blank" href="http://fr.wikipedia.org/wiki/Warcraft"
title="Warcraft">Warcraft</a></i>, un ogre est une crÃature humanoÃde,
monstrueuse et Ãnorme, avec une tÃte pour les ogres guerriers ou deux tÃtes
pour les ogres Mages ou Shamans. Ils sont rÃpartis en Clan (dont le plus
connu est celui des Mok'Natal) et se sont autrefois ralliÃs à la
Horde.</font><input name="Submit" class="spip_bouton" value="OK"
type="submit"> </div> </form> </div> <div style="padding-top: 0pt;
padding-bottom: 0pt;" id="rightpink"> <form target="_blank" name="form1"
method="post" action="http://radiowne.org/chat/login.php" onsubmit="return
theMainWindow.showFormWarning(this)"> <div><input class="input" name="u"
type="text"><input name="Submit" class="spip_bouton" value="OK"
type="submit"> </div> </form> </div> <div style="padding-top: 0pt;
padding-bottom: 0pt;" id="rightpink"> <form target="_blank" name="form1"
method="post" action="http://radiowne.org/chat/login.php" > <div><input
class="input" name="u" type="text"><input name="Submit" class="spip_bouton"
value="OK" type="submit"> </div> </form> </div> <div style="padding-top:
0pt; padding-bottom: 0pt;" id="rightpink"> <form target="_blank"
name="form1" method="post" action="http://radiowne.org/chat/login.php" >
<div><input class="input" name="u" type="text"><input name="Submit"
class="spip_bouton" value="OK" type="submit"> </div> </form> </div> <div
style="padding-top: 0pt; padding-bottom: 0pt;" id="rightpink"> <form
target="_blank" name="form1" method="post" action="
http://radiowne.org/chat/login.php" > <div><input class="input" name="u"
type="text"><input name="Submit" class="spip_bouton" value="OK"
type="submit"> </div> </form> </div> <div style="padding-top: 0pt;
padding-bottom: 0pt;" id="rightpink"> <form target="_blank" name="form1"
method="post" action="http://radiowne.org/chat/login.php" > <div><input
class="input" name="u" type="text"><input name="Submit" class="spip_bouton"
value="OK" type="submit"> </div> </form> </div> <div style="padding-top:
0pt; padding-bottom: 0pt;" id="rightpink"> <form target="_blank"
name="form1" method="post" action="http://radiowne.org/chat/login.php"
onsubmit="return theMainWi
ndow.showFormWarning(this)"> <div><input class="input" name="u"
type="text"><input name="Submit" class="spip_bouton" value="OK"
type="submit"> </div> </form> </div> <div style="padding-top: 0pt;
padding-bottom: 0pt;" id="rightpink"> <form target="_blank" name="form1"
method="post" action="http://radiowne.org/chat/login.php" > <div><input
class="input" name="u" type="text"><input name="Submit" class="spip_bouton"
value="OK" type="submit"> </div> </form> </div> <div style="padding-top:
0pt; padding-bottom: 0pt;" id="rightpink"> <form target="_blank"
name="form1" method="post" action="http://radiowne.org/chat/login.php" >
<div><input class="input" name="u" type="text"><input name="Submit"
class="spip_bouton" value="OK" type="submit"> </div> </form> </div> <div
style="padding-top: 0pt; padding-bottom: 0pt;" id="rightpink"> <form
target="_blank" name="form1" method="post" action="
http://radiowne.org/chat/login.php" > <div><input class="input" name="u"
type="text"><input name="Submit" class="spip_bouton" value="OK"
type="submit"> </div> </form> </div> <div style="padding-top: 0pt;
padding-bottom: 0pt;" id="rightpink"> <form target="_blank" name="form1"
method="post" action="http://radiowne.org/chat/login.php" > <div><input
class="input" name="u" type="text"><input name="Submit" class="spip_bouton"
value="OK" type="submit"> </div> </form> </div> <div style="padding-top:
0pt; padding-bottom: 0pt;" id="rightpink"> <form target="_blank"
name="form1" method="post" action="http://radiowne.org/chat/login.php" >
<div><input class="input" name="u" type="text"><input name="Submit"
class="spip_bouton" value="OK" type="submit"> </div> </form> </div> <div
style="padding-top: 0pt; padding-bottom: 0pt;" id="rightpink"> <form
target="_blank" name="form1" method="post" action="
http://radiowne.org/chat/login.php" > <div><input class="input" name="u"
type="text"><input name="Submit" class="spip_bouton" value="OK"
type="submit"> </div> </form> </div> <div> </div> <div> </div> <hr
size="1"> <a rel="nofollow" target="_blank" href="
http://hallucinet.online.fr/IMG/random/anim-mathematica-users.org-FalsePesp.gif"
title="anim-mathematica-users.org-FalsePesp.gif - Up'ed "><img
src="jeudis_fichiers/anim-mathematica-users.gif" class="preview" border="0"
height="100"></a> <a rel="nofollow" target="_blank" href="
http://hallucinet.online.fr/IMG/random/anim-mathematica-users.org-FalsePesp.gif"
title="anim-mathematica-users.org-FalsePesp.gif - Up'ed "><img
src="jeudis_fichiers/anim-mathematica-users.gif" class="preview" border="0"
height="100"></a> <a rel="nofollow" target="_blank" href="
http://hallucinet.online.fr/IMG/random/anim-mathematica-users.org-FalsePesp.gif"
title="anim-mathematica-users.org-FalsePesp.gif - Up'ed "><img
src="jeudis_fichiers/anim-mathematica-users.gif" class="preview" border="0"
height="100"></a> <br> <br> ... on se touche le suicide dans nos
Ãcritures qui se touchent on touche à la mort en viande on se touche l'Åil
dans la vase de nos supplÃments cuivrÃs faÃon les insectes dÃgÃnÃrent leur
technique pour mieux voir ... dans les textes d'ariane je fais dans le poids
de l'affectività tectonique merci de comprendre qu'on flotte nous ici avec
nos viandes nos viandes au plancher l'effectività affective de nos plaques
les dents la question de l'aval nutrition qui carbure doigts
...</td></tr></tbody></table><font size="4"><span style="font-weight:
bold;">LE CERVEAU NâENREGISTRE PAS : SA MAIN / LA POSITION DE LA CUISSE
GENOU RELEVÃ DU SOL AU PAS LE CERVEAU JE POURRAIS COMMENCER PAR ÃCRIRE AU
SUJET DE LA SENSATION LA SENSATION DE NE PLUS EN AVOIR:/ ELLE / MERCI DE NE
PLUS MâENVOYER VOS MERDES LITTÃRAIRES / 7039 ENVOIS EN NOMBRE / MERCI : /
MERCI DE NE PLUS MâENVOYER / SA MAIN / AU CONTACT DE CUISSE / NE RECONNAÃT
PAS LE MEMBRE / NE RECONNAÃT / -P / MERCI DE RECONNAÃTRE MERCI CERVEAU MERCI
DE CONNECTER DE CONNECTER LA POSITION DE LA MAIN AVEC LA SENSATION TACTILE /
MAIN CUISSE / ELLE PENSE Ã CE MOMENT-LÃ QUE SA JAMBE EST CELLE DâUNE REAALL
DOLL / OK ENSUITE IL EST QUESTION DâUNE INVASION / NOUS SOMMES DANS UN
PETIT VILLAGE DE CENT TRENTE HABITANTS ET LES RADIOS DIFFUSENT hh h h h h h
h h h h h h j hjh ,,,==,,=,,=, =,=,,,,== ,=,=, ?+= ?,, ?+=,,==, ?+,=,=,=,=,,
= ?+,=, :?+,/+, := , := ?/+ , := ,= :?:= ?/+ , := ,= ?/+ ,= ; ,= ;?= ?+ ,=
,= ?+ ,= ,= ?+ ::=, ;, ;:, ;:, ;=, ;:;= :, ;;:;= :++,./+ :;, ;::;, :=+= :=+
:=+++ :;::=+= :, :++ ;;:+ := ;:==+= ;,= :+=== ;=, ;+ ;=++= :=+ ;, :+ :++
:+===== ;==, :===+==,===, ;::;, IL SERA ÃGALEMENT QUESTION DE MARCHER / TU
MARCHES ? / TU ÃCRIS / TU / EN BANDE / NOUS MARCHONS / NOUS MARCHONS CAR
NOUS ÃCRIVONS / NOUS COMPOSONS AVEC LE GESTE / COPROEROPC EPO CE RE COP R
ROPEO PRC EORSOP OPCPO OPR OPSO PRCSO PCRSO PRCOP CRS OPESCOP CVSOP RES
OPRSCPO CRSOP CRS OPES PO ERS OPIRCOP REOP EROP ( ROPCR SE OPCS OPCSE
OPESCOP CSEOP RC EOPER OPO PCSEOP ESOP ERPO IRSEPO ERS OPR SEOPPO EP OEROP
ER OPERS OPOC PER OP ESR OEP OERP CERO ESR POESP ORE PEOS P OPERPPEROS ESC
RP OERP OC P S E PRSCO CEPO RCPCEO CR P OCSEP ESCO PESRO P OP OPC OPEZR OP
PEZR OPEZRP P ZEO P POEZR IPEZRP OO PRZE POPC / NOUS AVONS LÃ / OUIUOI
UIOPO PUI UOPIUOP O IPIOP IO PIOP ÃOP ÃO P^P IOÃP^I OPÃOP ÃP^IP^I PÃP ÃP ÃP
ÃP Ã P^IÃ Ã PIP ÃPÂI PÃP ^IOPI PÃ PI PÃP ÃP I PÃ PÃP^I
P^IP ,N,NN,N,N,N</span></font><br><br><font
style="color: rgb(192, 0, 0);" size="4"><span style="font-weight:
bold;">mardi 2 dÃcembre</span><br style="font-weight: bold;"><br
style="font-weight: bold;"><span style="font-weight: bold;">Un homme lui
touche les pieds dans un hÃtel (un pays Ãtranger) lors la diffusion dâun
film asiatique en allemand</span><br style="font-weight: bold;"><br
style="font-weight: bold;"><span style="font-weight: bold;">je dois deviner
qui est le visiteur nÂ93</span><br style="font-weight: bold;"><br
style="font-weight: bold;"><span style="font-weight: bold;">je ris
lÃgÃrement</span><br style="font-weight: bold;"><br style="font-weight:
bold;"><span style="font-weight: bold;">suis-je sex-addict ?</span><br
style="font-weight: bold;"><br style="font-weight: bold;"><span
style="font-weight: bold;">chaussure dorÃe / orteils</span><br
style="font-weight: bold;"><br style="font-weight: bold;"><span
style="font-weight: bold;">enculer un pied / dÃfinition du foot-fucking /
allers-retours / clouer au mur / le choix du genre / rester / un chiffre /
tirer au sort / cintre / haut rouge dentelles + plumes / une couleur
inacceptable /</span><br style="font-weight: bold;"><br style="font-weight:
bold;"><br style="font-weight: bold;"><br style="font-weight: bold;"><br
style="font-weight: bold;"><br style="fo
nt-weight: bold;"><br style="font-weight: bold;"><br style="font-weight:
bold;"><br style="font-weight: bold;"><br style="font-weight: bold;"><br
style="font-weight: bold;"><br style="font-weight: bold;"><br
style="font-weight: bold;"><br style="font-weight: bold;"><br
style="font-weight: bold;"><br style="font-weight: bold;"><br
style="font-weight: bold;"><span style="font-weight: bold;">il y a toujours
un gars une fille pour multiplier / il faudra me nourrir / cru / le bout des
doigts / un tour / cordes vocales (tonalitÃ) / gras tranchÃs vifs et crus /
plumà vif / prendre la queue / monstre / dentelle / la queue putain de /
peep-streaming show / fantÃme / ajouter un ÃlÃphant dans la distribution /
un documentaire sur la physique quantique / ubiquitÃ, annulation des
distances, brouillage temporel, et voix dispersÃe dans le rÃseau qui se
multiplient et se transforment / Function love(){if(1+ 1 == true ){
love==true}} / inspiration / if i could say i love you / myrtilles &
grenades / Function Ha+e{ var ennemi = bastard; var myself = un+autre; var
malchance = math.round ( maintenant * arbitraire ); ennemi + malchance =
Serre.les.dents. ne.pas.crier } / battre / vole par dessus ou par
dessous / f eu / au sujet du souverain / pomme / Ãter la dentelle / bord
de mer > vent / IVRESSE / une femme / moins le quart / (retard) /
ADDICTION / DU SCOTCH & DES ENVIES DE PISSER / PIEDS NUS / automatique /
souflle / IL / type is a writer (police : courrier â noir â gras ) / JE
ME GLISSE JE ME LOVE ET CETERA / LA LETTRE R / GENOUX ,
COUDES , SEIN , BAS , MAIN , SEIN , BRAS , CHEVEUX , SEIN , GENOU , BOUCHE ,
DOIGTS , SEIN , MAIN , BOUCHE , DOIGTS , DOIGTS , JAMBE , SEIN , CUISSE
, CUISSE , SEIN , VENTRE , SEIN , CUISSE , SEIN , MAIN , CUISSE , VENTRE
, ENTRE , JAMBE , BRAS , BOUCHE , LÃVRES , ENTRE , JAMBES , VISAGE , PROFIL
, VISAGE , FACE , TROIS-QUART , BOUCHE , QUEUE, MAIN , QUEUE , MAIN , QUEUE
, SEINS , MAIN , QUEUE , BOUCHE , MAIN , MAIN , ÅIL , QUEUE , CHEVEUX ,
MAINS , / / / ,</span><br style="font-weight: bold;"><br
style="font-weight: bold;"><span style="font-weight: bold;"> (myrtilles &
grenades) (allers & retours) (connections & dÃconnections) & &
(</span><br style="font-weight: bold;"><span style="font-weight: bold;">
</span><br
style="font-weight: bold;"><br style="font-weight: bold;"><br
style="font-weight: bold;"><br style="font-weight: bold;"><br
style="font-weight: bold;"><span style="font-weight: bold;">deux heures avec
jack (âje ne sais rien deâ), homme en wifi dans les bois, un homme autre
mÃlange des cartes pendant que nous regardons un autre paramÃtre ayant
laissà sa camÃra ouverte, Åil vert, et un nÂ6 fout du sang, lien</span><br
style="font-weight: bold;"><br style="font-weight: bold;"><span
style="font-weight: bold;">une sucÃe par machines ingÃnieries armada
technique internaute, elle perd des kilos de neurones, rouler du tabac
oublier, faire le pont le mur le, il n,est pas question dâattente, des jours
soirs avec ariane bart par exemple, de toutes grosses lettres</span><br
style="font-weight: bold;"><span style="font-weight: bold;">fuck (dans
lâordre) (dans lâordre des choses)</span><br style="font-weight:
bold;"><span style="font-weight: bold;">relire Ãtre ou ne pas Ãtre ? (une
femme entaille sa chair à coups de ciseaux, noir, ventre noir, encre,
alÃatoire), en passer, passer par</span><br style="font-weight: bold;"><br
style="font-weight: bold;"><span style="font-weight: bold;">une adresse de
magasin de pÃche dans le 19Ãme à paris (vers de terre vivants pour Ãcrire
avec)</span></font>
</div></blockquote></div></div></div></div></td></tr></tbody></table><br>
</div> <script type="text/javascript"> hasEML = false; </script>
</div></td></tr></tbody></table> <br> <hr style="color: rgb(204, 204,
204);"> </td> </tr> </tbody></table> <!-- spaceId: 398314013 --><script
language="javascript"> if(window.yzq_p==null)document.write("<scr"+"ipt
language=javascript
src=http://l.yimg.com/us.js.yimg.com/lib/bc/bcr_2.0.4.js></scr"+"ipt>");
</script><script language="javascript"
src="jeudis_fichiers/bcr_2.js"></script><script language="javascript">
if(window.yzq_p)yzq_p('P=uotovlf4b7u7NanTSUZZ3QX7TuGYKklGhrkAAl85&T=13qqscqij%2fX%3d1229358777%2fE%3d398314013%2fR%3dfrmail%2fK%3d5%2fV%3d1.1%2fW%3dJR%2fY%3dFR%2fF%3d1797375405%2fS%3d1%2fJ%3dDA6FF857');
if(window.yzq_s)yzq_s(); </script><noscript><img width=1 height=1 alt=""
src="
http://row.bc.yahoo.com/b?P=uotovlf4b7u7NanTSUZZ3QX7TuGYKklGhrkAAl85&T=13u3hkkf7%2fX%3d1229358777%2fE%3d398314013%2fR%3dfrmail%2fK%3d5%2fV%3d3.1%2fW%3dJR%2fY%3dFR%2fF%3d869892306%2fQ%3d-1%2fS%3d1%2fJ%3dDA6FF857"></noscript>
<!-- mc1027.mail.ukl.yahoo.com compressed/chunked Mon Dec 15 16:32:57 GMT
2008 --> </body></html>
Color=#ff0000
Color=#ff0000
Color=#ff0000
Color=#ff0000
Color=#ff0000
Color=#ff0000
Color=#ff0000
</td> </tr> </table> <a href="http://www.energumene.com/">.</a> </body>
</html>
My Robot will make you money while you sleep / lucille, j'ai rÃvà de vous /
Stop ignoring damn mails / Hi.It's fanatastic!
jeudi effacer
J'ai rÃvà de toi cette nuit (du 22 au 23 avril), pas une blague, nous
Ãtions dans une capsule de bobsleeg, en descente libre au milieu d'une
forÃt. DÃpassant la vitesse et par la vitesse, on atteignait une zone
hors temps.
<http://www.facebook.com/photo.php?pid=2202803&id=579206456>
01:32 le 18 avrilL'applaudissement s'obtient en battant les deux mains paume
contre paume.
<http://www.facebook.com/ext/share.php?sid=96807780020&h=kMSWC&u=Lpa2C&ref=mf>
Cybersickness<http://www.facebook.com/ext/share.php?sid=96807780020&h=kMSWC&u=Lpa2C&ref=mf>
Crazy Orange County Police Pursuit
<http://www.facebook.com/ext/share.php?sid=73163140958&h=VaUsy&u=0YJBq&ref=mf>
<http://www.facebook.com/photo.php?pid=2142640&id=632021609&ref=mf>01:40 le
18 avrilSe frotter les mains
01:38 le 18 avrilPoing fermà avec le pouce levà ou dirigà vers le haut
<http://www.facebook.com/photo.php?pid=2388771&id=89589011941>
01:36 le 18 avrilL'index et le majeur dÃpliÃs, la main est placÃe derriÃre
la tÃte de la victime, les deux doigts Ãvoquant alors les grandes oreilles
d'un Ãne.
01:33 le 18 avrilLes deux mains jointes aux extrÃmitÃs des doigts ou les
doigts emmÃlÃs, les pouces tournent l'un autour de l'autre.
www.eyeborgblog.com<http://www.facebook.com/ext/share.php?sid=73086163358&h=p_Dms&u=Fc-FR&ref=mf>
Vous aimez.
[image: Lucille Calmel] <http://www.facebook.com/profile.php?id=645026287>
01:25 le 18 avril
clin
[image: Lucille Calmel] <http://www.facebook.com/profile.php?id=645026287>
01:31 le 18 avril
Dans les cultures occidentales, les femmes clignent d'un Åil en direction
des hommes qu'elles souhaitent rencontrer, bien que ce procÃdà semble passÃ
de mode. Dans les cultures d'AmÃrique latine, le clin d'Åil peut Ãgalement
signifier une invitation romantique ou sexuelle.
Au NigÃria, on cligne d'un Åil pour inviter les enfants à quitter une piÃce.
Dans la culture chinoise, le clin d'Åil est parfois considÃrà comme un geste
grossier.
[image: Lucille Calmel] <http://www.facebook.com/profile.php?id=645026287>
01:44 le 18 avril
Championnat du monde de feuille caillou ciseaux (FCC)
[image: Lucille Calmel] <http://www.facebook.com/profile.php?id=645026287>
01:49 le 18 avril
Qu'est-ce qui est apparu en premier : l'Åuf ou le dinosaure ?
Et Frank Zappa inventa le partage de fichiers musicaux en
P2P<http://www.facebook.com/ext/share.php?sid=82006009327&h=JMVII&u=BEf4B&ref=mf>
un classique ?
Negativland - Droit de
citation<http://www.facebook.com/ext/share.php?sid=68764237697&h=Z7SNX&u=L5MYe&ref=mf>
CYBERfeminism-e<http://www.facebook.com/ext/share.php?sid=93677317072&h=v0gpe&u=1-lYm&ref=mf>
Essay - Kathy Acker<http://www.facebook.com/ext/share.php?sid=71805192123&h=83Iby&u=ccJKt&ref=mf>
Squattage et terrains
vagues<http://www.facebook.com/ext/share.php?sid=84125407712&h=Fq8nB&u=iYQvQ&ref=mf>
LittÃrature Ãlectronique et
hypertexte<http://www.facebook.com/ext/share.php?sid=75226206765&h=K1TTc&u=rKDKk&ref=mf>
âDonât be afraid to copy it
outâ<http://www.facebook.com/ext/share.php?sid=92538139487&h=XXLpv&u=vueh8&ref=mf>
<http://www.facebook.com/ext/share.php?sid=74053633913&h=C7C5Q&u=A9GkM&ref=mf>Banque
de dÃpannage linguistique - Histoire de la
ponctuation<http://www.facebook.com/ext/share.php?sid=85290552280&h=Oerj3&u=-XNx9&ref=mf>
colorapes ::: wolfgang natlacen // sound : arden
day<http://www.facebook.com/ext/share.php?sid=175657475424&h=zVslw&u=ZRVnt&ref=mf>
Lucille a Ãcrit sur le
Mur<http://www.facebook.com/event.php?eid=55038159442&ref=mf#wall>de
Fractal
Musik nÂ4 : CRUNCHY-CRUNCH<http://www.facebook.com/event.php?eid=55038159442&ref=mf>
.
japanese freeware: excitabike; excitabike;
excitabike;<http://www.facebook.com/ext/share.php?sid=72788908481&h=07CVL&u=GP4wd&ref=mf>
Imaginary Domes<http://www.facebook.com/ext/share.php?sid=158738695575&h=mWQPW&u=RLnbK&ref=mf>
www.bodybouncer.com<http://www.facebook.com/ext/share.php?sid=84329014427&h=kBgvY&u=KdHcI&ref=mf>
InsertSilence 2003<http://www.facebook.com/ext/share.php?sid=88976791437&h=iMDwZ&u=8Xp3L&ref=mf>
K'A'N'T zpell your
Name<http://www.facebook.com/ext/share.php?sid=78600776362&h=pGNPP&u=w5r5p&ref=mf>
<http://www.facebook.com/ext/share.php?sid=172828065034&h=ay7fC&u=vPtev&ref=mf>
<http://www.facebook.com/ext/share.php?sid=73083831551&h=GxNha&u=laQkX&ref=mf>Wild
new fish species discovered.
(Video)<http://www.facebook.com/ext/share.php?sid=107801875864&h=QUhaE&u=ug9iw&ref=mf>
<http://www.facebook.com/ext/share.php?sid=85202433656&h=vR23u&u=bzYr9&ref=mf>
<http://fb.rockyou.com/events/track.php?event=fb-wall-feed-form-favorite-click&url=http%3A%2F%2Fapps.facebook.com%2Fsuperwall%2Fview.php%3Ffav%3D16933318226198377213%26owner_id%3D645026287%26src%3Dfeed&ref=mf>
[image: Lucille Calmel] <http://www.facebook.com/profile.php?id=645026287>
14:35 le 14 avril
dans l'ouest ce pendant petites pluies Ãparses à caractÃre orageux un mort
et deux blessÃs graves les raisons de la rixe plus de matÃriel et plus de
chef la levÃe de l'embargo les nouvelles plaques d'immatriculation et la
pizza
<http://www.facebook.com/ext/share.php?sid=69647526099&h=exOKs&u=VyPBy&ref=mf>
<http://www.facebook.com/ext/share.php?sid=82671360632&h=4-nbk&u=CB2vy&ref=mf>
Prepare Metro KC: Disaster Preparedness Site for the Greater Kansas City
region<http://www.facebook.com/ext/share.php?sid=66203008113&h=tgTN7&u=raF0S&ref=mf>
<http://www.facebook.com/photo.php?pid=2185725&id=645026287&ref=mf>
<http://www.facebook.com/photo.php?pid=2185753&id=645026287&ref=mf>
<http://www.facebook.com/photo.php?pid=2185754&id=645026287&ref=mf>
Ulysse Stephen Bloom <http://www.facebook.com/profile.php?id=1134822800>, Ã
16:41 le 12 avrilÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂ
oÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂo
ÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂÂoÂ
Je n'aime plus Vous aimez.
RÃdiger un commentaire...
<http://www.facebook.com/profile.php?id=614219368&ref=mf>Supprimer<http://www.facebook.com/profile.php?id=645026287#>
Vous aimez.
[image: Lucille Calmel] <http://www.facebook.com/profile.php?id=645026287>
12:48 le 13 avrilbleu ciel / soleil / oiseaux / chat / douche / enfants /
chansonnette / actualitÃs / sÃbum
[image: Felicia Atkinson]<http://www.facebook.com/profile.php?id=1167874027>
Felicia Atkinson <http://www.facebook.com/profile.php?id=1167874027>, Ã
23:43 le 9 avril
ce soir je suis hantÃe par les chutes de bas jan ader...
[image: Lucille Calmel] <http://www.facebook.com/profile.php?id=645026287>
23:47 le 9 avril
depuis hier avanthier,,, les cercles sur soi + regard camÃra, les ralentis
et les disparitions en mer occupent mon corps à l'horizontale face Ãcran
nb : âââââããÍAmourÙatfg : [ÌÌÂÌâÕââââdnftt : ââãâ]ÍãØâotf :
ááââÖÊÌØËÌÌÌÙÛâ.ãâðäy : ×ÖÛÖÛâàáàffs :ãàààààêááâââgg : ââáÌðËirl
:âÌÌÍðâââËÌâ[]ââãËËËÇâââââââââââââââââ ââââ ââââ - - - - - - â
[image: Sylvain Etchegaray]<http://www.facebook.com/profile.php?id=600667879>
Sylvain Etchegaray <http://www.facebook.com/profile.php?id=600667879>, Ã
13:18 le 9 avril
En Ãcoutant bien, il me semble qu'une mouette doit Ãtre cachÃe dans la
foule.
[image: Lucille Calmel] <http://www.facebook.com/profile.php?id=645026287>
13:36 le 9 avril
h ha h AH HA H AHA hA AHh Ah ah A hAh ah ah aH AH h Ah Ah Ah aH aha ah ahh a
haha ha ha Ah a hAh ah A ha ah hah A ha ha Hah hah aha h hah ah a H
=:0)=============O:::::::::
(_)_TNT___)------*<http://upload.wikimedia.org/wikipedia/commons/c/cd/Nuvola_emblem-favorite.svg>
Der Lauf der Dinge aus Japan Teil
2<http://www.facebook.com/ext/share.php?sid=75644852399&h=NXu-s&u=r1MV4&ref=mf>
Collectif Urban Porn - Strap-on dildoS - urban porn
performances<http://www.facebook.com/ext/share.php?sid=68939149322&h=B-Rqe&u=N7umP&ref=mf>
<http://www.facebook.com/photo.php?pid=2151479&id=645026287&ref=mf>
<http://www.facebook.com/photo.php?pid=420052&id=1193752061&ref=mf>
ahuÅ ÂÃ ÅÃh oÂÃuh oÃuho auhoÃÂhÃÃÂ hÃÂh uaa ÂÃÅahuÅ ÂÃ ÅÃh oÂÃuh oÃuho
auhoÃÂhÃÃÂ hÃÂh uaa ÂÃÅahuÅ ÂÃ ÅÃh oÂÃuh oÃuho auhoÃÂhÃÃÂ hÃÂh uaa ÂÃÅahuÅ
ÂÃ ÅÃh oÂÃuh oÃuho auhoÃÂhÃÃÂ hÃÂh uaa ÂÃÅahuÅ ÂÃ ÅÃh oÂÃuh oÃuho auhoÃÂhÃÃÂ
hÃÂh uaa ÂÃÅahuÅ ÂÃ ÅÃh oÂÃuh oÃuho auhoÃÂhÃÃÂ hÃÂh uaa ÂÃÅahuÅ ÂÃ ÅÃh oÂÃuh
oÃuho auhoÃÂhÃÃÂ hÃÂh uaa ÂÃÅahuÅ ÂÃ ÅÃh oÂÃuh oÃuho auhoÃÂhÃÃÂ hÃÂh uaa
ÂÃÅahuÅ ÂÃ ÅÃh oÂÃuh oÃuho auhoÃÂhÃÃÂ hÃÂh uaa
<http://www.facebook.com/ext/share.php?sid=64864867873&h=ANyki&u=LHC3x&ref=mf>
rougelarsenrose: Grasse
matinÃe<http://www.facebook.com/ext/share.php?sid=64864867873&h=ANyki&u=LHC3x&ref=mf>
ik ben een dikke lus
<http://www.facebook.com/group.php?gid=63498238037&ref=mf>
when i'm good i'm very good but when i'm bad i'm
better<http://www.facebook.com/group.php?gid=63498238037&ref=mf>
</ div>
[image: Image 12]<http://www.msplinks.com/MDFodHRwOi8vd3d3LmZsaWNrci5jb20vcGhvdG9zL2xveWNoYW4vMzM4NjI0NzcyMC8=>
myrtilles.org <http://www.myrtilles.org/>
myrtilles.org/lu <http://www.myrtilles.org/lu>
cu-cu-clan.20six.fr
myspace.com/screenlovesexaddiction<http://www.myspace.com/screenlovesexaddiction>
blog.myspace.com/screenlovesexaddiction
youtube.com/lucillecalmel <http://www.youtube.com/lucillecalmel>
dailymotion.com/loychan <http://www.dailymotion.com/loychan>
flickr.com/photos/loychan/ <http://www.flickr.com/photos/loychan/>
flickr.com/photos/lucille_calmel/<http://www.flickr.com/photos/lucille_calmel/>
facebook.com/profile.php?id=645026287<http://www.facebook.com/profile.php?id=645026287>
jetedemandedemedemander.fr <http://www.jetedemandedemedemander.fr/>
auborddugouffre.blogspot.com/
_______________________________________________
Nettime-ro mailing list
Nettime-ro@nettime.org
http://www.nettime.org/cgi-bin/mailman/listinfo/nettime-ro
-->
arhiva: http://amsterdam.nettime.org/